ID: 936900320

View in Genome Browser
Species Human (GRCh38)
Location 2:117474529-117474551
Sequence CCTGAAGGAAGCACTAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12581
Summary {0: 1048, 1: 5770, 2: 3765, 3: 1309, 4: 689}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936900314_936900320 2 Left 936900314 2:117474504-117474526 CCACCAGGCCTGCCTCACGGGAG No data
Right 936900320 2:117474529-117474551 CCTGAAGGAAGCACTAAATATGG 0: 1048
1: 5770
2: 3765
3: 1309
4: 689
936900315_936900320 -1 Left 936900315 2:117474507-117474529 CCAGGCCTGCCTCACGGGAGTTC No data
Right 936900320 2:117474529-117474551 CCTGAAGGAAGCACTAAATATGG 0: 1048
1: 5770
2: 3765
3: 1309
4: 689
936900318_936900320 -10 Left 936900318 2:117474516-117474538 CCTCACGGGAGTTCCTGAAGGAA No data
Right 936900320 2:117474529-117474551 CCTGAAGGAAGCACTAAATATGG 0: 1048
1: 5770
2: 3765
3: 1309
4: 689
936900316_936900320 -6 Left 936900316 2:117474512-117474534 CCTGCCTCACGGGAGTTCCTGAA No data
Right 936900320 2:117474529-117474551 CCTGAAGGAAGCACTAAATATGG 0: 1048
1: 5770
2: 3765
3: 1309
4: 689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936900320 Original CRISPR CCTGAAGGAAGCACTAAATA TGG Intergenic
Too many off-targets to display for this crispr