ID: 936900321

View in Genome Browser
Species Human (GRCh38)
Location 2:117474534-117474556
Sequence AGGAAGCACTAAATATGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12264
Summary {0: 969, 1: 5603, 2: 3687, 3: 1295, 4: 710}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936900318_936900321 -5 Left 936900318 2:117474516-117474538 CCTCACGGGAGTTCCTGAAGGAA No data
Right 936900321 2:117474534-117474556 AGGAAGCACTAAATATGGAAAGG 0: 969
1: 5603
2: 3687
3: 1295
4: 710
936900315_936900321 4 Left 936900315 2:117474507-117474529 CCAGGCCTGCCTCACGGGAGTTC No data
Right 936900321 2:117474534-117474556 AGGAAGCACTAAATATGGAAAGG 0: 969
1: 5603
2: 3687
3: 1295
4: 710
936900316_936900321 -1 Left 936900316 2:117474512-117474534 CCTGCCTCACGGGAGTTCCTGAA No data
Right 936900321 2:117474534-117474556 AGGAAGCACTAAATATGGAAAGG 0: 969
1: 5603
2: 3687
3: 1295
4: 710
936900314_936900321 7 Left 936900314 2:117474504-117474526 CCACCAGGCCTGCCTCACGGGAG No data
Right 936900321 2:117474534-117474556 AGGAAGCACTAAATATGGAAAGG 0: 969
1: 5603
2: 3687
3: 1295
4: 710

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936900321 Original CRISPR AGGAAGCACTAAATATGGAA AGG Intergenic
Too many off-targets to display for this crispr