ID: 936913488

View in Genome Browser
Species Human (GRCh38)
Location 2:117616092-117616114
Sequence CAGTACTGGCAGAAGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936913488_936913492 6 Left 936913488 2:117616092-117616114 CCACTCTGCTTCTGCCAGTACTG No data
Right 936913492 2:117616121-117616143 TCTATGAAGGCTCTTCCTTGTGG No data
936913488_936913490 -7 Left 936913488 2:117616092-117616114 CCACTCTGCTTCTGCCAGTACTG No data
Right 936913490 2:117616108-117616130 AGTACTGCCTGAATCTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936913488 Original CRISPR CAGTACTGGCAGAAGCAGAG TGG (reversed) Intergenic
No off target data available for this crispr