ID: 936917761

View in Genome Browser
Species Human (GRCh38)
Location 2:117657279-117657301
Sequence CTGGGTAAACAGGAAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936917761_936917768 26 Left 936917761 2:117657279-117657301 CCCTCTTCTTCCTGTTTACCCAG No data
Right 936917768 2:117657328-117657350 CAGTTCCTGTTACCTGTTCCGGG No data
936917761_936917767 25 Left 936917761 2:117657279-117657301 CCCTCTTCTTCCTGTTTACCCAG No data
Right 936917767 2:117657327-117657349 TCAGTTCCTGTTACCTGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936917761 Original CRISPR CTGGGTAAACAGGAAGAAGA GGG (reversed) Intergenic
No off target data available for this crispr