ID: 936918227

View in Genome Browser
Species Human (GRCh38)
Location 2:117661615-117661637
Sequence CACCTGCCTGTTGGATCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936918227_936918231 -9 Left 936918227 2:117661615-117661637 CCATAGGATCCAACAGGCAGGTG No data
Right 936918231 2:117661629-117661651 AGGCAGGTGGTCAGGTGATATGG No data
936918227_936918232 14 Left 936918227 2:117661615-117661637 CCATAGGATCCAACAGGCAGGTG No data
Right 936918232 2:117661652-117661674 ACGAGCATAAATGTAGACAGCGG No data
936918227_936918233 22 Left 936918227 2:117661615-117661637 CCATAGGATCCAACAGGCAGGTG No data
Right 936918233 2:117661660-117661682 AAATGTAGACAGCGGAACTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936918227 Original CRISPR CACCTGCCTGTTGGATCCTA TGG (reversed) Intergenic
No off target data available for this crispr