ID: 936918554

View in Genome Browser
Species Human (GRCh38)
Location 2:117664424-117664446
Sequence TGGTCTATGCAAAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936918554_936918559 10 Left 936918554 2:117664424-117664446 CCTTCCTCCTTTTGCATAGACCA No data
Right 936918559 2:117664457-117664479 ATCTATGATCACAAACAAGGAGG No data
936918554_936918558 7 Left 936918554 2:117664424-117664446 CCTTCCTCCTTTTGCATAGACCA No data
Right 936918558 2:117664454-117664476 AGAATCTATGATCACAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936918554 Original CRISPR TGGTCTATGCAAAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr