ID: 936920986 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:117687948-117687970 |
Sequence | GACACTACCTTGCCTAGGAG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
936920986_936920988 | -7 | Left | 936920986 | 2:117687948-117687970 | CCTCTCCTAGGCAAGGTAGTGTC | No data | ||
Right | 936920988 | 2:117687964-117687986 | TAGTGTCAGCAAAGACCTAGTGG | No data | ||||
936920986_936920989 | -6 | Left | 936920986 | 2:117687948-117687970 | CCTCTCCTAGGCAAGGTAGTGTC | No data | ||
Right | 936920989 | 2:117687965-117687987 | AGTGTCAGCAAAGACCTAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
936920986 | Original CRISPR | GACACTACCTTGCCTAGGAG AGG (reversed) | Intergenic | ||