ID: 936920986

View in Genome Browser
Species Human (GRCh38)
Location 2:117687948-117687970
Sequence GACACTACCTTGCCTAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936920986_936920988 -7 Left 936920986 2:117687948-117687970 CCTCTCCTAGGCAAGGTAGTGTC No data
Right 936920988 2:117687964-117687986 TAGTGTCAGCAAAGACCTAGTGG No data
936920986_936920989 -6 Left 936920986 2:117687948-117687970 CCTCTCCTAGGCAAGGTAGTGTC No data
Right 936920989 2:117687965-117687987 AGTGTCAGCAAAGACCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936920986 Original CRISPR GACACTACCTTGCCTAGGAG AGG (reversed) Intergenic