ID: 936920988

View in Genome Browser
Species Human (GRCh38)
Location 2:117687964-117687986
Sequence TAGTGTCAGCAAAGACCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936920985_936920988 -6 Left 936920985 2:117687947-117687969 CCCTCTCCTAGGCAAGGTAGTGT No data
Right 936920988 2:117687964-117687986 TAGTGTCAGCAAAGACCTAGTGG No data
936920984_936920988 -2 Left 936920984 2:117687943-117687965 CCATCCCTCTCCTAGGCAAGGTA No data
Right 936920988 2:117687964-117687986 TAGTGTCAGCAAAGACCTAGTGG No data
936920986_936920988 -7 Left 936920986 2:117687948-117687970 CCTCTCCTAGGCAAGGTAGTGTC No data
Right 936920988 2:117687964-117687986 TAGTGTCAGCAAAGACCTAGTGG No data
936920980_936920988 24 Left 936920980 2:117687917-117687939 CCATTGCAGGAGCAGTAACAAGG No data
Right 936920988 2:117687964-117687986 TAGTGTCAGCAAAGACCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936920988 Original CRISPR TAGTGTCAGCAAAGACCTAG TGG Intergenic
No off target data available for this crispr