ID: 936923489

View in Genome Browser
Species Human (GRCh38)
Location 2:117712940-117712962
Sequence CCGAGGGAGCAATCCATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936923483_936923489 24 Left 936923483 2:117712893-117712915 CCATAGAGCTGCTTGACTGTCTC No data
Right 936923489 2:117712940-117712962 CCGAGGGAGCAATCCATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936923489 Original CRISPR CCGAGGGAGCAATCCATGAG AGG Intergenic
No off target data available for this crispr