ID: 936925782

View in Genome Browser
Species Human (GRCh38)
Location 2:117735307-117735329
Sequence AAGTGGGGAGAGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936925771_936925782 26 Left 936925771 2:117735258-117735280 CCAGTAGAAAGTTTCTTTGAATG No data
Right 936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936925782 Original CRISPR AAGTGGGGAGAGAGGGAAGG AGG Intergenic
No off target data available for this crispr