ID: 936935592

View in Genome Browser
Species Human (GRCh38)
Location 2:117836077-117836099
Sequence GCTCCCGGCGTCTCCAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936935580_936935592 30 Left 936935580 2:117836024-117836046 CCAAAAAACTGCAAAAGGGAGCC No data
Right 936935592 2:117836077-117836099 GCTCCCGGCGTCTCCAGCAGAGG No data
936935584_936935592 9 Left 936935584 2:117836045-117836067 CCTCCTTCTGGGAAGTCTCCGGC No data
Right 936935592 2:117836077-117836099 GCTCCCGGCGTCTCCAGCAGAGG No data
936935588_936935592 -9 Left 936935588 2:117836063-117836085 CCGGCCCTTCCGCGGCTCCCGGC No data
Right 936935592 2:117836077-117836099 GCTCCCGGCGTCTCCAGCAGAGG No data
936935585_936935592 6 Left 936935585 2:117836048-117836070 CCTTCTGGGAAGTCTCCGGCCCT No data
Right 936935592 2:117836077-117836099 GCTCCCGGCGTCTCCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936935592 Original CRISPR GCTCCCGGCGTCTCCAGCAG AGG Intergenic