ID: 936938279

View in Genome Browser
Species Human (GRCh38)
Location 2:117858982-117859004
Sequence GGGCGGGAGCAAGGGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936938279_936938296 25 Left 936938279 2:117858982-117859004 CCAGCTGCCCCTTGCTCCCGCCC No data
Right 936938296 2:117859030-117859052 CGTCTCCCGACGCCGCTGGGTGG No data
936938279_936938294 21 Left 936938279 2:117858982-117859004 CCAGCTGCCCCTTGCTCCCGCCC No data
Right 936938294 2:117859026-117859048 AGCTCGTCTCCCGACGCCGCTGG No data
936938279_936938285 -5 Left 936938279 2:117858982-117859004 CCAGCTGCCCCTTGCTCCCGCCC No data
Right 936938285 2:117859000-117859022 CGCCCACCCCCGCCCACTGCAGG No data
936938279_936938298 27 Left 936938279 2:117858982-117859004 CCAGCTGCCCCTTGCTCCCGCCC No data
Right 936938298 2:117859032-117859054 TCTCCCGACGCCGCTGGGTGGGG No data
936938279_936938295 22 Left 936938279 2:117858982-117859004 CCAGCTGCCCCTTGCTCCCGCCC No data
Right 936938295 2:117859027-117859049 GCTCGTCTCCCGACGCCGCTGGG No data
936938279_936938297 26 Left 936938279 2:117858982-117859004 CCAGCTGCCCCTTGCTCCCGCCC No data
Right 936938297 2:117859031-117859053 GTCTCCCGACGCCGCTGGGTGGG No data
936938279_936938299 28 Left 936938279 2:117858982-117859004 CCAGCTGCCCCTTGCTCCCGCCC No data
Right 936938299 2:117859033-117859055 CTCCCGACGCCGCTGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936938279 Original CRISPR GGGCGGGAGCAAGGGGCAGC TGG (reversed) Intergenic