ID: 936938287

View in Genome Browser
Species Human (GRCh38)
Location 2:117859003-117859025
Sequence GCACCTGCAGTGGGCGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936938287_936938304 12 Left 936938287 2:117859003-117859025 CCACCCCCGCCCACTGCAGGTGC No data
Right 936938304 2:117859038-117859060 GACGCCGCTGGGTGGGGGAGGGG No data
936938287_936938297 5 Left 936938287 2:117859003-117859025 CCACCCCCGCCCACTGCAGGTGC No data
Right 936938297 2:117859031-117859053 GTCTCCCGACGCCGCTGGGTGGG No data
936938287_936938299 7 Left 936938287 2:117859003-117859025 CCACCCCCGCCCACTGCAGGTGC No data
Right 936938299 2:117859033-117859055 CTCCCGACGCCGCTGGGTGGGGG No data
936938287_936938303 11 Left 936938287 2:117859003-117859025 CCACCCCCGCCCACTGCAGGTGC No data
Right 936938303 2:117859037-117859059 CGACGCCGCTGGGTGGGGGAGGG No data
936938287_936938295 1 Left 936938287 2:117859003-117859025 CCACCCCCGCCCACTGCAGGTGC No data
Right 936938295 2:117859027-117859049 GCTCGTCTCCCGACGCCGCTGGG No data
936938287_936938296 4 Left 936938287 2:117859003-117859025 CCACCCCCGCCCACTGCAGGTGC No data
Right 936938296 2:117859030-117859052 CGTCTCCCGACGCCGCTGGGTGG No data
936938287_936938302 10 Left 936938287 2:117859003-117859025 CCACCCCCGCCCACTGCAGGTGC No data
Right 936938302 2:117859036-117859058 CCGACGCCGCTGGGTGGGGGAGG No data
936938287_936938294 0 Left 936938287 2:117859003-117859025 CCACCCCCGCCCACTGCAGGTGC No data
Right 936938294 2:117859026-117859048 AGCTCGTCTCCCGACGCCGCTGG No data
936938287_936938298 6 Left 936938287 2:117859003-117859025 CCACCCCCGCCCACTGCAGGTGC No data
Right 936938298 2:117859032-117859054 TCTCCCGACGCCGCTGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936938287 Original CRISPR GCACCTGCAGTGGGCGGGGG TGG (reversed) Intergenic
No off target data available for this crispr