ID: 936938296

View in Genome Browser
Species Human (GRCh38)
Location 2:117859030-117859052
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936938284_936938296 8 Left 936938284 2:117858999-117859021 CCGCCCACCCCCGCCCACTGCAG No data
Right 936938296 2:117859030-117859052 CGTCTCCCGACGCCGCTGGGTGG No data
936938292_936938296 -5 Left 936938292 2:117859012-117859034 CCCACTGCAGGTGCAGCTCGTCT No data
Right 936938296 2:117859030-117859052 CGTCTCCCGACGCCGCTGGGTGG No data
936938280_936938296 18 Left 936938280 2:117858989-117859011 CCCCTTGCTCCCGCCCACCCCCG No data
Right 936938296 2:117859030-117859052 CGTCTCCCGACGCCGCTGGGTGG No data
936938287_936938296 4 Left 936938287 2:117859003-117859025 CCACCCCCGCCCACTGCAGGTGC No data
Right 936938296 2:117859030-117859052 CGTCTCCCGACGCCGCTGGGTGG No data
936938293_936938296 -6 Left 936938293 2:117859013-117859035 CCACTGCAGGTGCAGCTCGTCTC No data
Right 936938296 2:117859030-117859052 CGTCTCCCGACGCCGCTGGGTGG No data
936938281_936938296 17 Left 936938281 2:117858990-117859012 CCCTTGCTCCCGCCCACCCCCGC No data
Right 936938296 2:117859030-117859052 CGTCTCCCGACGCCGCTGGGTGG No data
936938291_936938296 -2 Left 936938291 2:117859009-117859031 CCGCCCACTGCAGGTGCAGCTCG No data
Right 936938296 2:117859030-117859052 CGTCTCCCGACGCCGCTGGGTGG No data
936938288_936938296 1 Left 936938288 2:117859006-117859028 CCCCCGCCCACTGCAGGTGCAGC No data
Right 936938296 2:117859030-117859052 CGTCTCCCGACGCCGCTGGGTGG No data
936938282_936938296 16 Left 936938282 2:117858991-117859013 CCTTGCTCCCGCCCACCCCCGCC No data
Right 936938296 2:117859030-117859052 CGTCTCCCGACGCCGCTGGGTGG No data
936938290_936938296 -1 Left 936938290 2:117859008-117859030 CCCGCCCACTGCAGGTGCAGCTC No data
Right 936938296 2:117859030-117859052 CGTCTCCCGACGCCGCTGGGTGG No data
936938283_936938296 9 Left 936938283 2:117858998-117859020 CCCGCCCACCCCCGCCCACTGCA No data
Right 936938296 2:117859030-117859052 CGTCTCCCGACGCCGCTGGGTGG No data
936938286_936938296 5 Left 936938286 2:117859002-117859024 CCCACCCCCGCCCACTGCAGGTG No data
Right 936938296 2:117859030-117859052 CGTCTCCCGACGCCGCTGGGTGG No data
936938289_936938296 0 Left 936938289 2:117859007-117859029 CCCCGCCCACTGCAGGTGCAGCT No data
Right 936938296 2:117859030-117859052 CGTCTCCCGACGCCGCTGGGTGG No data
936938279_936938296 25 Left 936938279 2:117858982-117859004 CCAGCTGCCCCTTGCTCCCGCCC No data
Right 936938296 2:117859030-117859052 CGTCTCCCGACGCCGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr