ID: 936938299

View in Genome Browser
Species Human (GRCh38)
Location 2:117859033-117859055
Sequence CTCCCGACGCCGCTGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936938283_936938299 12 Left 936938283 2:117858998-117859020 CCCGCCCACCCCCGCCCACTGCA No data
Right 936938299 2:117859033-117859055 CTCCCGACGCCGCTGGGTGGGGG No data
936938279_936938299 28 Left 936938279 2:117858982-117859004 CCAGCTGCCCCTTGCTCCCGCCC No data
Right 936938299 2:117859033-117859055 CTCCCGACGCCGCTGGGTGGGGG No data
936938286_936938299 8 Left 936938286 2:117859002-117859024 CCCACCCCCGCCCACTGCAGGTG No data
Right 936938299 2:117859033-117859055 CTCCCGACGCCGCTGGGTGGGGG No data
936938281_936938299 20 Left 936938281 2:117858990-117859012 CCCTTGCTCCCGCCCACCCCCGC No data
Right 936938299 2:117859033-117859055 CTCCCGACGCCGCTGGGTGGGGG No data
936938289_936938299 3 Left 936938289 2:117859007-117859029 CCCCGCCCACTGCAGGTGCAGCT No data
Right 936938299 2:117859033-117859055 CTCCCGACGCCGCTGGGTGGGGG No data
936938291_936938299 1 Left 936938291 2:117859009-117859031 CCGCCCACTGCAGGTGCAGCTCG No data
Right 936938299 2:117859033-117859055 CTCCCGACGCCGCTGGGTGGGGG No data
936938287_936938299 7 Left 936938287 2:117859003-117859025 CCACCCCCGCCCACTGCAGGTGC No data
Right 936938299 2:117859033-117859055 CTCCCGACGCCGCTGGGTGGGGG No data
936938293_936938299 -3 Left 936938293 2:117859013-117859035 CCACTGCAGGTGCAGCTCGTCTC No data
Right 936938299 2:117859033-117859055 CTCCCGACGCCGCTGGGTGGGGG No data
936938290_936938299 2 Left 936938290 2:117859008-117859030 CCCGCCCACTGCAGGTGCAGCTC No data
Right 936938299 2:117859033-117859055 CTCCCGACGCCGCTGGGTGGGGG No data
936938284_936938299 11 Left 936938284 2:117858999-117859021 CCGCCCACCCCCGCCCACTGCAG No data
Right 936938299 2:117859033-117859055 CTCCCGACGCCGCTGGGTGGGGG No data
936938280_936938299 21 Left 936938280 2:117858989-117859011 CCCCTTGCTCCCGCCCACCCCCG No data
Right 936938299 2:117859033-117859055 CTCCCGACGCCGCTGGGTGGGGG No data
936938292_936938299 -2 Left 936938292 2:117859012-117859034 CCCACTGCAGGTGCAGCTCGTCT No data
Right 936938299 2:117859033-117859055 CTCCCGACGCCGCTGGGTGGGGG No data
936938288_936938299 4 Left 936938288 2:117859006-117859028 CCCCCGCCCACTGCAGGTGCAGC No data
Right 936938299 2:117859033-117859055 CTCCCGACGCCGCTGGGTGGGGG No data
936938282_936938299 19 Left 936938282 2:117858991-117859013 CCTTGCTCCCGCCCACCCCCGCC No data
Right 936938299 2:117859033-117859055 CTCCCGACGCCGCTGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936938299 Original CRISPR CTCCCGACGCCGCTGGGTGG GGG Intergenic
No off target data available for this crispr