ID: 936938321

View in Genome Browser
Species Human (GRCh38)
Location 2:117859115-117859137
Sequence CCGGGTGCCACCGGCCGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936938321_936938326 -8 Left 936938321 2:117859115-117859137 CCCTGGCGGCCGGTGGCACCCGG No data
Right 936938326 2:117859130-117859152 GCACCCGGGACCGCTAAGAGAGG No data
936938321_936938328 -5 Left 936938321 2:117859115-117859137 CCCTGGCGGCCGGTGGCACCCGG No data
Right 936938328 2:117859133-117859155 CCCGGGACCGCTAAGAGAGGTGG No data
936938321_936938334 8 Left 936938321 2:117859115-117859137 CCCTGGCGGCCGGTGGCACCCGG No data
Right 936938334 2:117859146-117859168 AGAGAGGTGGTAGGAGGGACTGG No data
936938321_936938332 2 Left 936938321 2:117859115-117859137 CCCTGGCGGCCGGTGGCACCCGG No data
Right 936938332 2:117859140-117859162 CCGCTAAGAGAGGTGGTAGGAGG No data
936938321_936938333 3 Left 936938321 2:117859115-117859137 CCCTGGCGGCCGGTGGCACCCGG No data
Right 936938333 2:117859141-117859163 CGCTAAGAGAGGTGGTAGGAGGG No data
936938321_936938330 -1 Left 936938321 2:117859115-117859137 CCCTGGCGGCCGGTGGCACCCGG No data
Right 936938330 2:117859137-117859159 GGACCGCTAAGAGAGGTGGTAGG No data
936938321_936938335 20 Left 936938321 2:117859115-117859137 CCCTGGCGGCCGGTGGCACCCGG No data
Right 936938335 2:117859158-117859180 GGAGGGACTGGCGAGCCGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936938321 Original CRISPR CCGGGTGCCACCGGCCGCCA GGG (reversed) Intergenic
No off target data available for this crispr