ID: 936940291

View in Genome Browser
Species Human (GRCh38)
Location 2:117877926-117877948
Sequence CTTGAAGCCAGCACAGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936940286_936940291 14 Left 936940286 2:117877889-117877911 CCTGTGGCCACCAGCACTGGTAC No data
Right 936940291 2:117877926-117877948 CTTGAAGCCAGCACAGAACCAGG No data
936940284_936940291 16 Left 936940284 2:117877887-117877909 CCCCTGTGGCCACCAGCACTGGT No data
Right 936940291 2:117877926-117877948 CTTGAAGCCAGCACAGAACCAGG No data
936940285_936940291 15 Left 936940285 2:117877888-117877910 CCCTGTGGCCACCAGCACTGGTA No data
Right 936940291 2:117877926-117877948 CTTGAAGCCAGCACAGAACCAGG No data
936940290_936940291 4 Left 936940290 2:117877899-117877921 CCAGCACTGGTACTGTGCTGGGT No data
Right 936940291 2:117877926-117877948 CTTGAAGCCAGCACAGAACCAGG No data
936940287_936940291 7 Left 936940287 2:117877896-117877918 CCACCAGCACTGGTACTGTGCTG No data
Right 936940291 2:117877926-117877948 CTTGAAGCCAGCACAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936940291 Original CRISPR CTTGAAGCCAGCACAGAACC AGG Intergenic
No off target data available for this crispr