ID: 936940782

View in Genome Browser
Species Human (GRCh38)
Location 2:117882266-117882288
Sequence AAACCATTCAACAAGTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936940782_936940784 3 Left 936940782 2:117882266-117882288 CCTGGAGACTTGTTGAATGGTTT No data
Right 936940784 2:117882292-117882314 CCAAAATGCTGATAGTGATATGG No data
936940782_936940785 4 Left 936940782 2:117882266-117882288 CCTGGAGACTTGTTGAATGGTTT No data
Right 936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG No data
936940782_936940786 18 Left 936940782 2:117882266-117882288 CCTGGAGACTTGTTGAATGGTTT No data
Right 936940786 2:117882307-117882329 TGATATGGGCAATGAAGTCCAGG No data
936940782_936940787 21 Left 936940782 2:117882266-117882288 CCTGGAGACTTGTTGAATGGTTT No data
Right 936940787 2:117882310-117882332 TATGGGCAATGAAGTCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936940782 Original CRISPR AAACCATTCAACAAGTCTCC AGG (reversed) Intergenic