ID: 936940785

View in Genome Browser
Species Human (GRCh38)
Location 2:117882293-117882315
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936940782_936940785 4 Left 936940782 2:117882266-117882288 CCTGGAGACTTGTTGAATGGTTT No data
Right 936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type