ID: 936941545

View in Genome Browser
Species Human (GRCh38)
Location 2:117889420-117889442
Sequence TATTGAGCAGGGTCCACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936941545_936941549 -5 Left 936941545 2:117889420-117889442 CCACAGGTGGACCCTGCTCAATA No data
Right 936941549 2:117889438-117889460 CAATACTGCAGTGGTAGAGCCGG No data
936941545_936941550 -4 Left 936941545 2:117889420-117889442 CCACAGGTGGACCCTGCTCAATA No data
Right 936941550 2:117889439-117889461 AATACTGCAGTGGTAGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936941545 Original CRISPR TATTGAGCAGGGTCCACCTG TGG (reversed) Intergenic
No off target data available for this crispr