ID: 936945997

View in Genome Browser
Species Human (GRCh38)
Location 2:117931447-117931469
Sequence GTCTCCAGACACTGCCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936945997_936946001 7 Left 936945997 2:117931447-117931469 CCCACCCGGCAGTGTCTGGAGAC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 936946001 2:117931477-117931499 ATTGTCACAACTGCGAGAAGTGG 0: 1
1: 0
2: 3
3: 32
4: 150
936945997_936946004 26 Left 936945997 2:117931447-117931469 CCCACCCGGCAGTGTCTGGAGAC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 936946004 2:117931496-117931518 GTGGGTGCTACTGGAATCACTGG 0: 1
1: 0
2: 0
3: 19
4: 671
936945997_936946003 17 Left 936945997 2:117931447-117931469 CCCACCCGGCAGTGTCTGGAGAC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 936946003 2:117931487-117931509 CTGCGAGAAGTGGGTGCTACTGG 0: 1
1: 0
2: 0
3: 12
4: 102
936945997_936946005 27 Left 936945997 2:117931447-117931469 CCCACCCGGCAGTGTCTGGAGAC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 936946005 2:117931497-117931519 TGGGTGCTACTGGAATCACTGGG 0: 1
1: 0
2: 0
3: 11
4: 230
936945997_936946002 8 Left 936945997 2:117931447-117931469 CCCACCCGGCAGTGTCTGGAGAC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 936946002 2:117931478-117931500 TTGTCACAACTGCGAGAAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936945997 Original CRISPR GTCTCCAGACACTGCCGGGT GGG (reversed) Intronic
900129213 1:1080521-1080543 GCCTCCAGACCCTGCCTGGCTGG + Intergenic
900159061 1:1214958-1214980 GTCTCCAAACACTGCCACATGGG - Intergenic
900524257 1:3120756-3120778 GTCCCCAGACTCTGCCTGGCTGG - Intronic
901534151 1:9871745-9871767 GACACCCGACACTGCCGGATTGG - Intronic
904528739 1:31154842-31154864 GTCTCCAGAGACAGTGGGGTGGG + Intergenic
912650151 1:111431212-111431234 GTCTCCAGACATTGCTAGATCGG - Intergenic
915910288 1:159910651-159910673 GTCACCAAACAGTGCAGGGTAGG + Intergenic
916578580 1:166088399-166088421 ATCTGCAGACCCTGCTGGGTGGG + Intronic
917908539 1:179615032-179615054 GTTACCAGACACTGAGGGGTGGG - Intronic
922707530 1:227797141-227797163 GGCTCCAGACACAGCAGGGGTGG + Intergenic
924280480 1:242432232-242432254 GACTCCAGAAACTACTGGGTAGG + Intronic
1064332393 10:14406053-14406075 GTCACCTCACACTGCCAGGTTGG + Intronic
1064870360 10:19930320-19930342 TTTTCCAGAAACAGCCGGGTTGG + Intronic
1074207121 10:111292628-111292650 CTCTCCAGACACAGCCTGGATGG - Intergenic
1077051278 11:568179-568201 GCCTGGAGGCACTGCCGGGTGGG + Intergenic
1080795439 11:35558860-35558882 GTCTCTAGACTCAGCAGGGTGGG + Intergenic
1085371071 11:76005940-76005962 ATCTCCAGACACTGCCAGTCTGG + Intronic
1088540785 11:110911502-110911524 GACTCCACACTCTGCAGGGTGGG - Intergenic
1098382606 12:69884511-69884533 TTCTCCAGACACTGACAGGGAGG - Intronic
1103008347 12:117439267-117439289 GTCTCCTGACACTGTCTGGGGGG + Intronic
1104120455 12:125794007-125794029 GTCTCCAGACACTGCCCCTGGGG + Intergenic
1107467600 13:40665021-40665043 GCCTCCAGAAACTGCCCGGCAGG + Intronic
1112917707 13:104571770-104571792 GTCTCCAAGCACTGACTGGTAGG + Intergenic
1113530338 13:111020120-111020142 GGCTCCTGACTCTGCCAGGTAGG - Intergenic
1114484403 14:23054441-23054463 TTCTCCAGACACTGTAGGGGTGG + Intronic
1114599744 14:23944837-23944859 GTCTAAAGACAATGCCAGGTTGG - Intergenic
1116028015 14:39537586-39537608 GTCTCCAGCCACTGCCAACTGGG + Intergenic
1116846333 14:49868094-49868116 GTCTCCAAACACTACAGGCTGGG + Intergenic
1119706684 14:76787439-76787461 GTCTCAAGACAGTGCCCTGTGGG - Exonic
1121420519 14:93810035-93810057 GTGTACAGACAATGCCAGGTTGG - Intergenic
1128756550 15:70187404-70187426 AGCTCCAGACACTGCTGGGCAGG + Intergenic
1129521116 15:76186870-76186892 GGCTCCAGGCTCTGCCTGGTGGG + Intronic
1131819927 15:96261964-96261986 ATCTCCAAACACTGCCTGGGTGG - Intergenic
1132635993 16:946936-946958 GTCTCCAGAGCCTGGCAGGTGGG - Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1133433324 16:5757514-5757536 GTCACCACACCCAGCCGGGTGGG + Intergenic
1134864000 16:17588565-17588587 GTCTCCAGACATTGCCTTGTGGG - Intergenic
1135917958 16:26622995-26623017 GTTGCCAGACACTGCCAGGCTGG - Intergenic
1137621449 16:49879184-49879206 GTGTCCAGATACTCCCAGGTCGG + Intergenic
1140925635 16:79580577-79580599 GTCTCCAGACGCTGCTTGGAGGG + Intergenic
1142219814 16:88848628-88848650 CTCCCCTGACACTGCTGGGTCGG + Intronic
1144631119 17:16873055-16873077 ATGTCCAGAGACTGCCGGGTGGG - Intergenic
1149596829 17:57869159-57869181 ATCTTCAGACACAGCGGGGTTGG + Exonic
1159300677 18:66562297-66562319 GTCTCCCATCACTGCCAGGTGGG - Intronic
1160520829 18:79507105-79507127 GTCGCCAGGCACTGCGGGGAGGG + Intronic
1161083916 19:2325220-2325242 GTCACCAGACACTGCGGAGCAGG - Intronic
1165894390 19:39132763-39132785 GTCATCAGACACTGGGGGGTGGG - Intronic
1166369708 19:42294014-42294036 GTGGCCAGAGACTGCAGGGTGGG - Exonic
1166583110 19:43920516-43920538 GTTTCCAGATGTTGCCGGGTGGG + Intronic
1166675835 19:44740487-44740509 GTCTCCAGCCAATGACAGGTGGG - Intergenic
931213040 2:60215496-60215518 GTCTCCAAACAAGGCCGGGAAGG + Intergenic
936938297 2:117859031-117859053 GTCTCCCGACGCCGCTGGGTGGG + Intergenic
936945997 2:117931447-117931469 GTCTCCAGACACTGCCGGGTGGG - Intronic
938192515 2:129296616-129296638 GGCACCAGACACTGCTGGGCTGG - Intergenic
947062407 2:226181522-226181544 GTCTCCAGACATTGCCAAATGGG - Intergenic
948473522 2:238202494-238202516 GTCTCCAGCCCCCGCTGGGTTGG + Intronic
948825223 2:240570711-240570733 GGCTCCAGACGCTGCAGGGCAGG - Intronic
948860369 2:240749968-240749990 GGCTGCAGAGACAGCCGGGTGGG + Intronic
1169345399 20:4824245-4824267 GTCCGCAGACACTGCAGGGTTGG - Intergenic
1171458619 20:25286026-25286048 CCCTCCAGACAGTGCCCGGTAGG - Intronic
1172904743 20:38360750-38360772 ATCTCCAAACTCTGCCAGGTAGG + Exonic
1175509606 20:59514984-59515006 CTTTCCACACACTGCCTGGTGGG - Intergenic
1178390490 21:32194007-32194029 GTCTCCAGACATTGTCAAGTGGG + Intergenic
1178446026 21:32643320-32643342 GCCTGCAAACACTGCGGGGTGGG + Intronic
1180228603 21:46413079-46413101 GTGTCCAGCCTCTCCCGGGTGGG - Intronic
1180228621 21:46413139-46413161 GTGTCCAGCCTCTCCCGGGTGGG - Intronic
1180228639 21:46413199-46413221 GTGTCCAGCCTCTCCCGGGTGGG - Intronic
1180228676 21:46413318-46413340 GTGTCCAGCCTCTCCCGGGTGGG - Intronic
1181050240 22:20234886-20234908 GTCCCCAGACTCTGCCAGGCTGG + Intergenic
1183936095 22:41263217-41263239 GTTTCCAGGCACTGCTGGGCAGG + Intronic
1184205466 22:42999684-42999706 GTCTACAGACTATGCCTGGTGGG + Intronic
950822492 3:15775909-15775931 TTCTCCAGAGACTGGGGGGTGGG + Intronic
954627985 3:52033134-52033156 GGCTCCAGGCAAGGCCGGGTTGG - Intergenic
958813118 3:98885834-98885856 GTCTCAAGACACTGCCAAATGGG - Intronic
960986159 3:123282448-123282470 GTCACCAGTCACTGCTGGGATGG + Exonic
961316079 3:126036511-126036533 GTTTCCAGATCCTGGCGGGTGGG - Intronic
961413344 3:126739516-126739538 GTCTCAAGAAACTAGCGGGTGGG + Intronic
962238524 3:133730242-133730264 GTCCCCAGAAACTCCTGGGTAGG - Intergenic
969717341 4:8874120-8874142 GCTTCCACACACTGCCGCGTGGG + Intergenic
980035817 4:127881382-127881404 GCCTCGGGACACTGCCGGGCGGG - Intronic
985486586 5:155189-155211 ATCTACAGACACTTCCGGGGCGG - Intronic
985752244 5:1687258-1687280 GTCTCCAGACAGTGCTGTTTTGG + Intergenic
992432962 5:76727530-76727552 GTCTCCAGACAATGAAGGGGTGG - Intronic
996957078 5:129196133-129196155 GCCTCCAGAAACTGGCAGGTAGG - Intergenic
1005312197 6:24569584-24569606 GTCTACAGTCACTGCAGGATGGG + Intronic
1006984708 6:38168891-38168913 TTCTCCAGGCACTGGGGGGTGGG + Exonic
1012129205 6:95469958-95469980 GTCTCCAGTCACAGCCAGGTTGG + Intergenic
1018165563 6:161090917-161090939 GTCTCCAGACGCTGAGGGGAGGG + Intronic
1019205865 6:170361053-170361075 GTCACCAGCCACTGTTGGGTAGG + Intronic
1019706054 7:2497871-2497893 GTCCCCAGACCCTGCCGGGGTGG + Intergenic
1019742160 7:2680370-2680392 GTCTCCAGTGCCTGCTGGGTGGG - Intronic
1019746494 7:2703058-2703080 GTCCCCAGACACTCCTGGGTGGG - Intronic
1032303451 7:130710750-130710772 GCCTCCAGACACTGCCTCGCAGG + Intergenic
1033210138 7:139454171-139454193 GTCTCCAGGCACTCCTGGGTGGG - Exonic
1035741232 8:1929988-1930010 CTCTCCAGCCCCTGCCGCGTTGG + Intronic
1036489011 8:9207230-9207252 CTCACCAGACACTCCCTGGTAGG - Intergenic
1037084098 8:14825711-14825733 GTTACCAGACACTGGAGGGTAGG - Intronic
1037596320 8:20357346-20357368 GTCTCCAGACATGGCTGGATTGG - Intergenic
1042059199 8:64798833-64798855 TTTTCCAGAAGCTGCCGGGTCGG - Intergenic
1049508012 8:143014104-143014126 GGCTCCAGACACCGCCTGCTGGG + Intergenic
1050151652 9:2623204-2623226 GTCCCCAGACTCTGCCGCGGGGG + Intronic
1051096322 9:13469716-13469738 GTCTCCACAGACTGCCAGGCTGG + Intergenic
1060279776 9:122208054-122208076 GTCTTCAGAGACTGCTGGGTTGG - Intronic
1061761588 9:132855410-132855432 GACTCCAGACAGTGGCGGGTGGG + Intronic
1186519982 X:10197351-10197373 GACACCAGACACTCCCGGCTGGG - Intronic
1192197430 X:69037969-69037991 GTCCCCTGCCACTGCTGGGTGGG - Intergenic
1195619068 X:106935159-106935181 CTCTCCAGACAGTGCTGAGTTGG - Intronic
1198148733 X:133886612-133886634 GTTACCAGACCCTGCGGGGTGGG - Intronic