ID: 936949784

View in Genome Browser
Species Human (GRCh38)
Location 2:117966298-117966320
Sequence TTTTATACACTGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936949778_936949784 10 Left 936949778 2:117966265-117966287 CCATGACAGACAGAGGACAGTCC No data
Right 936949784 2:117966298-117966320 TTTTATACACTGATGGAGGAAGG No data
936949777_936949784 16 Left 936949777 2:117966259-117966281 CCTAAGCCATGACAGACAGAGGA No data
Right 936949784 2:117966298-117966320 TTTTATACACTGATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936949784 Original CRISPR TTTTATACACTGATGGAGGA AGG Intronic
No off target data available for this crispr