ID: 936950011

View in Genome Browser
Species Human (GRCh38)
Location 2:117968229-117968251
Sequence CAGAAGAAAGAAAAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936950011_936950014 -5 Left 936950011 2:117968229-117968251 CCAGCTTCCTTTTCTTTCTTCTG No data
Right 936950014 2:117968247-117968269 TTCTGGCTCCTATCAAGCTTAGG No data
936950011_936950016 -3 Left 936950011 2:117968229-117968251 CCAGCTTCCTTTTCTTTCTTCTG No data
Right 936950016 2:117968249-117968271 CTGGCTCCTATCAAGCTTAGGGG No data
936950011_936950021 9 Left 936950011 2:117968229-117968251 CCAGCTTCCTTTTCTTTCTTCTG No data
Right 936950021 2:117968261-117968283 AAGCTTAGGGGGTTGCAGGGCGG No data
936950011_936950015 -4 Left 936950011 2:117968229-117968251 CCAGCTTCCTTTTCTTTCTTCTG No data
Right 936950015 2:117968248-117968270 TCTGGCTCCTATCAAGCTTAGGG No data
936950011_936950020 6 Left 936950011 2:117968229-117968251 CCAGCTTCCTTTTCTTTCTTCTG No data
Right 936950020 2:117968258-117968280 ATCAAGCTTAGGGGGTTGCAGGG No data
936950011_936950022 22 Left 936950011 2:117968229-117968251 CCAGCTTCCTTTTCTTTCTTCTG No data
Right 936950022 2:117968274-117968296 TGCAGGGCGGAAATATATTTTGG No data
936950011_936950017 -2 Left 936950011 2:117968229-117968251 CCAGCTTCCTTTTCTTTCTTCTG No data
Right 936950017 2:117968250-117968272 TGGCTCCTATCAAGCTTAGGGGG No data
936950011_936950019 5 Left 936950011 2:117968229-117968251 CCAGCTTCCTTTTCTTTCTTCTG No data
Right 936950019 2:117968257-117968279 TATCAAGCTTAGGGGGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936950011 Original CRISPR CAGAAGAAAGAAAAGGAAGC TGG (reversed) Intronic
No off target data available for this crispr