ID: 936950427

View in Genome Browser
Species Human (GRCh38)
Location 2:117972571-117972593
Sequence GCACCCACTGCTGTTTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936950427_936950430 18 Left 936950427 2:117972571-117972593 CCTGTAGAAACAGCAGTGGGTGC No data
Right 936950430 2:117972612-117972634 TTTTTTTTTTCTGAAAAACTGGG No data
936950427_936950429 17 Left 936950427 2:117972571-117972593 CCTGTAGAAACAGCAGTGGGTGC No data
Right 936950429 2:117972611-117972633 TTTTTTTTTTTCTGAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936950427 Original CRISPR GCACCCACTGCTGTTTCTAC AGG (reversed) Intronic