ID: 936955836

View in Genome Browser
Species Human (GRCh38)
Location 2:118021263-118021285
Sequence GGACCTTGGGGACCACCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936955827_936955836 2 Left 936955827 2:118021238-118021260 CCAACTGGATGGTCTGGCCCCAT No data
Right 936955836 2:118021263-118021285 GGACCTTGGGGACCACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936955836 Original CRISPR GGACCTTGGGGACCACCAGG AGG Intergenic
No off target data available for this crispr