ID: 936958184

View in Genome Browser
Species Human (GRCh38)
Location 2:118044572-118044594
Sequence CTTTCCCCACAGATGTAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936958178_936958184 13 Left 936958178 2:118044536-118044558 CCTCATGTCTCATCATCCCAGAG No data
Right 936958184 2:118044572-118044594 CTTTCCCCACAGATGTAACCAGG No data
936958183_936958184 -4 Left 936958183 2:118044553-118044575 CCAGAGGAAAAGGGTGTCTCTTT No data
Right 936958184 2:118044572-118044594 CTTTCCCCACAGATGTAACCAGG No data
936958182_936958184 -3 Left 936958182 2:118044552-118044574 CCCAGAGGAAAAGGGTGTCTCTT No data
Right 936958184 2:118044572-118044594 CTTTCCCCACAGATGTAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936958184 Original CRISPR CTTTCCCCACAGATGTAACC AGG Intergenic
No off target data available for this crispr