ID: 936958555

View in Genome Browser
Species Human (GRCh38)
Location 2:118048661-118048683
Sequence GCAACATAGCTATCTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936958555_936958560 22 Left 936958555 2:118048661-118048683 CCAGCAGGAGATAGCTATGTTGC No data
Right 936958560 2:118048706-118048728 TCTGATTGACAGGATGCTGTGGG No data
936958555_936958559 21 Left 936958555 2:118048661-118048683 CCAGCAGGAGATAGCTATGTTGC No data
Right 936958559 2:118048705-118048727 ATCTGATTGACAGGATGCTGTGG No data
936958555_936958558 12 Left 936958555 2:118048661-118048683 CCAGCAGGAGATAGCTATGTTGC No data
Right 936958558 2:118048696-118048718 GGAGCATCTATCTGATTGACAGG No data
936958555_936958556 -9 Left 936958555 2:118048661-118048683 CCAGCAGGAGATAGCTATGTTGC No data
Right 936958556 2:118048675-118048697 CTATGTTGCCTGTTCAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936958555 Original CRISPR GCAACATAGCTATCTCCTGC TGG (reversed) Intergenic
No off target data available for this crispr