ID: 936958557

View in Genome Browser
Species Human (GRCh38)
Location 2:118048683-118048705
Sequence TAGATGCTCCTTCTCTGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936958557_936958563 26 Left 936958557 2:118048683-118048705 CCTGTTCAGAGAAGGAGCATCTA No data
Right 936958563 2:118048732-118048754 AAGTGGACGTTGGCAGTTGACGG No data
936958557_936958562 16 Left 936958557 2:118048683-118048705 CCTGTTCAGAGAAGGAGCATCTA No data
Right 936958562 2:118048722-118048744 CTGTGGGTAGAAGTGGACGTTGG No data
936958557_936958559 -1 Left 936958557 2:118048683-118048705 CCTGTTCAGAGAAGGAGCATCTA No data
Right 936958559 2:118048705-118048727 ATCTGATTGACAGGATGCTGTGG No data
936958557_936958558 -10 Left 936958557 2:118048683-118048705 CCTGTTCAGAGAAGGAGCATCTA No data
Right 936958558 2:118048696-118048718 GGAGCATCTATCTGATTGACAGG No data
936958557_936958560 0 Left 936958557 2:118048683-118048705 CCTGTTCAGAGAAGGAGCATCTA No data
Right 936958560 2:118048706-118048728 TCTGATTGACAGGATGCTGTGGG No data
936958557_936958561 9 Left 936958557 2:118048683-118048705 CCTGTTCAGAGAAGGAGCATCTA No data
Right 936958561 2:118048715-118048737 CAGGATGCTGTGGGTAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936958557 Original CRISPR TAGATGCTCCTTCTCTGAAC AGG (reversed) Intergenic
No off target data available for this crispr