ID: 936958560

View in Genome Browser
Species Human (GRCh38)
Location 2:118048706-118048728
Sequence TCTGATTGACAGGATGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936958555_936958560 22 Left 936958555 2:118048661-118048683 CCAGCAGGAGATAGCTATGTTGC No data
Right 936958560 2:118048706-118048728 TCTGATTGACAGGATGCTGTGGG No data
936958557_936958560 0 Left 936958557 2:118048683-118048705 CCTGTTCAGAGAAGGAGCATCTA No data
Right 936958560 2:118048706-118048728 TCTGATTGACAGGATGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936958560 Original CRISPR TCTGATTGACAGGATGCTGT GGG Intergenic
No off target data available for this crispr