ID: 936960759

View in Genome Browser
Species Human (GRCh38)
Location 2:118071933-118071955
Sequence AAGTCCAATTTTTAACTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936960754_936960759 2 Left 936960754 2:118071908-118071930 CCCCAATTAACTACAAAAAGTCC No data
Right 936960759 2:118071933-118071955 AAGTCCAATTTTTAACTTCTTGG No data
936960756_936960759 0 Left 936960756 2:118071910-118071932 CCAATTAACTACAAAAAGTCCCT No data
Right 936960759 2:118071933-118071955 AAGTCCAATTTTTAACTTCTTGG No data
936960751_936960759 11 Left 936960751 2:118071899-118071921 CCCTCTGTCCCCCAATTAACTAC No data
Right 936960759 2:118071933-118071955 AAGTCCAATTTTTAACTTCTTGG No data
936960753_936960759 3 Left 936960753 2:118071907-118071929 CCCCCAATTAACTACAAAAAGTC No data
Right 936960759 2:118071933-118071955 AAGTCCAATTTTTAACTTCTTGG No data
936960752_936960759 10 Left 936960752 2:118071900-118071922 CCTCTGTCCCCCAATTAACTACA No data
Right 936960759 2:118071933-118071955 AAGTCCAATTTTTAACTTCTTGG No data
936960755_936960759 1 Left 936960755 2:118071909-118071931 CCCAATTAACTACAAAAAGTCCC No data
Right 936960759 2:118071933-118071955 AAGTCCAATTTTTAACTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936960759 Original CRISPR AAGTCCAATTTTTAACTTCT TGG Intergenic
No off target data available for this crispr