ID: 936968187

View in Genome Browser
Species Human (GRCh38)
Location 2:118147761-118147783
Sequence TGTAACAAACAACCACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3307
Summary {0: 3, 1: 19, 2: 155, 3: 785, 4: 2345}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936968187 Original CRISPR TGTAACAAACAACCACAAAC TGG Intergenic
Too many off-targets to display for this crispr