ID: 936973084

View in Genome Browser
Species Human (GRCh38)
Location 2:118193267-118193289
Sequence AGGGGAACCCTGCAGATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936973079_936973084 8 Left 936973079 2:118193236-118193258 CCTACAGTCATACTAGAAGGAGA No data
Right 936973084 2:118193267-118193289 AGGGGAACCCTGCAGATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936973084 Original CRISPR AGGGGAACCCTGCAGATTGG AGG Intergenic
No off target data available for this crispr