ID: 936974733

View in Genome Browser
Species Human (GRCh38)
Location 2:118207716-118207738
Sequence AAAATCTCAGACCCCACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936974733_936974737 18 Left 936974733 2:118207716-118207738 CCTGGGGTGGGGTCTGAGATTTT No data
Right 936974737 2:118207757-118207779 AGAGCAATGCAGATACTGCTGGG No data
936974733_936974738 19 Left 936974733 2:118207716-118207738 CCTGGGGTGGGGTCTGAGATTTT No data
Right 936974738 2:118207758-118207780 GAGCAATGCAGATACTGCTGGGG No data
936974733_936974736 17 Left 936974733 2:118207716-118207738 CCTGGGGTGGGGTCTGAGATTTT No data
Right 936974736 2:118207756-118207778 CAGAGCAATGCAGATACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936974733 Original CRISPR AAAATCTCAGACCCCACCCC AGG (reversed) Intergenic
No off target data available for this crispr