ID: 936974734

View in Genome Browser
Species Human (GRCh38)
Location 2:118207740-118207762
Sequence TGCTCTGGAGCTCGTTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936974734_936974738 -5 Left 936974734 2:118207740-118207762 CCTTTCTAACGAGCTCCAGAGCA No data
Right 936974738 2:118207758-118207780 GAGCAATGCAGATACTGCTGGGG No data
936974734_936974737 -6 Left 936974734 2:118207740-118207762 CCTTTCTAACGAGCTCCAGAGCA No data
Right 936974737 2:118207757-118207779 AGAGCAATGCAGATACTGCTGGG No data
936974734_936974741 20 Left 936974734 2:118207740-118207762 CCTTTCTAACGAGCTCCAGAGCA No data
Right 936974741 2:118207783-118207805 CAGCTGCATTTTGAATAGCAAGG No data
936974734_936974736 -7 Left 936974734 2:118207740-118207762 CCTTTCTAACGAGCTCCAGAGCA No data
Right 936974736 2:118207756-118207778 CAGAGCAATGCAGATACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936974734 Original CRISPR TGCTCTGGAGCTCGTTAGAA AGG (reversed) Intergenic
No off target data available for this crispr