ID: 936974736

View in Genome Browser
Species Human (GRCh38)
Location 2:118207756-118207778
Sequence CAGAGCAATGCAGATACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936974734_936974736 -7 Left 936974734 2:118207740-118207762 CCTTTCTAACGAGCTCCAGAGCA No data
Right 936974736 2:118207756-118207778 CAGAGCAATGCAGATACTGCTGG No data
936974733_936974736 17 Left 936974733 2:118207716-118207738 CCTGGGGTGGGGTCTGAGATTTT No data
Right 936974736 2:118207756-118207778 CAGAGCAATGCAGATACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936974736 Original CRISPR CAGAGCAATGCAGATACTGC TGG Intergenic
No off target data available for this crispr