ID: 936974993

View in Genome Browser
Species Human (GRCh38)
Location 2:118209658-118209680
Sequence GAGTATCCCTGAGGGCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936974987_936974993 12 Left 936974987 2:118209623-118209645 CCTGTAGGTAGCCTTGTGGATGG No data
Right 936974993 2:118209658-118209680 GAGTATCCCTGAGGGCAAGTTGG No data
936974989_936974993 1 Left 936974989 2:118209634-118209656 CCTTGTGGATGGTAAGATTCCAG No data
Right 936974993 2:118209658-118209680 GAGTATCCCTGAGGGCAAGTTGG No data
936974986_936974993 13 Left 936974986 2:118209622-118209644 CCCTGTAGGTAGCCTTGTGGATG No data
Right 936974993 2:118209658-118209680 GAGTATCCCTGAGGGCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936974993 Original CRISPR GAGTATCCCTGAGGGCAAGT TGG Intergenic
No off target data available for this crispr