ID: 936976923

View in Genome Browser
Species Human (GRCh38)
Location 2:118229840-118229862
Sequence AGTCCAGGCAGAGAAGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936976923_936976927 9 Left 936976923 2:118229840-118229862 CCAGTGGCTTCTCTGCCTGGACT No data
Right 936976927 2:118229872-118229894 ACATAGCTACACATAGCCTAGGG No data
936976923_936976930 22 Left 936976923 2:118229840-118229862 CCAGTGGCTTCTCTGCCTGGACT No data
Right 936976930 2:118229885-118229907 TAGCCTAGGGGTTGGAGCAGTGG No data
936976923_936976929 14 Left 936976923 2:118229840-118229862 CCAGTGGCTTCTCTGCCTGGACT No data
Right 936976929 2:118229877-118229899 GCTACACATAGCCTAGGGGTTGG No data
936976923_936976926 8 Left 936976923 2:118229840-118229862 CCAGTGGCTTCTCTGCCTGGACT No data
Right 936976926 2:118229871-118229893 CACATAGCTACACATAGCCTAGG No data
936976923_936976928 10 Left 936976923 2:118229840-118229862 CCAGTGGCTTCTCTGCCTGGACT No data
Right 936976928 2:118229873-118229895 CATAGCTACACATAGCCTAGGGG No data
936976923_936976931 23 Left 936976923 2:118229840-118229862 CCAGTGGCTTCTCTGCCTGGACT No data
Right 936976931 2:118229886-118229908 AGCCTAGGGGTTGGAGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936976923 Original CRISPR AGTCCAGGCAGAGAAGCCAC TGG (reversed) Intergenic
No off target data available for this crispr