ID: 936980502

View in Genome Browser
Species Human (GRCh38)
Location 2:118260726-118260748
Sequence GGTAATAAGTTTATTGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936980497_936980502 14 Left 936980497 2:118260689-118260711 CCTGGAGGTACTCAAGGACAGCA No data
Right 936980502 2:118260726-118260748 GGTAATAAGTTTATTGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936980502 Original CRISPR GGTAATAAGTTTATTGCCAT TGG Intergenic
No off target data available for this crispr