ID: 936980881

View in Genome Browser
Species Human (GRCh38)
Location 2:118264095-118264117
Sequence TCCTCCTGATTCCAATGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936980878_936980881 -9 Left 936980878 2:118264081-118264103 CCGGCCTCTCTCCATCCTCCTGA No data
Right 936980881 2:118264095-118264117 TCCTCCTGATTCCAATGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936980881 Original CRISPR TCCTCCTGATTCCAATGAAC AGG Intergenic
No off target data available for this crispr