ID: 936981054

View in Genome Browser
Species Human (GRCh38)
Location 2:118265729-118265751
Sequence GCTGCTGATGCACAACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936981054_936981059 20 Left 936981054 2:118265729-118265751 CCTGCTTGTTGTGCATCAGCAGC No data
Right 936981059 2:118265772-118265794 CTAGGCAGCACCGTGTGTGCAGG No data
936981054_936981057 2 Left 936981054 2:118265729-118265751 CCTGCTTGTTGTGCATCAGCAGC No data
Right 936981057 2:118265754-118265776 GCCTGGAGGAGCAAGCATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936981054 Original CRISPR GCTGCTGATGCACAACAAGC AGG (reversed) Intergenic
No off target data available for this crispr