ID: 936981059

View in Genome Browser
Species Human (GRCh38)
Location 2:118265772-118265794
Sequence CTAGGCAGCACCGTGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936981053_936981059 26 Left 936981053 2:118265723-118265745 CCAGAGCCTGCTTGTTGTGCATC No data
Right 936981059 2:118265772-118265794 CTAGGCAGCACCGTGTGTGCAGG No data
936981054_936981059 20 Left 936981054 2:118265729-118265751 CCTGCTTGTTGTGCATCAGCAGC No data
Right 936981059 2:118265772-118265794 CTAGGCAGCACCGTGTGTGCAGG No data
936981058_936981059 -6 Left 936981058 2:118265755-118265777 CCTGGAGGAGCAAGCATCTAGGC No data
Right 936981059 2:118265772-118265794 CTAGGCAGCACCGTGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936981059 Original CRISPR CTAGGCAGCACCGTGTGTGC AGG Intergenic
No off target data available for this crispr