ID: 936983732

View in Genome Browser
Species Human (GRCh38)
Location 2:118288540-118288562
Sequence TGGGCTGGCTGCAAGACAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936983726_936983732 13 Left 936983726 2:118288504-118288526 CCACCAATGCTAGGAAGGCTGGG No data
Right 936983732 2:118288540-118288562 TGGGCTGGCTGCAAGACAATAGG No data
936983724_936983732 14 Left 936983724 2:118288503-118288525 CCCACCAATGCTAGGAAGGCTGG No data
Right 936983732 2:118288540-118288562 TGGGCTGGCTGCAAGACAATAGG No data
936983728_936983732 10 Left 936983728 2:118288507-118288529 CCAATGCTAGGAAGGCTGGGTAA No data
Right 936983732 2:118288540-118288562 TGGGCTGGCTGCAAGACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936983732 Original CRISPR TGGGCTGGCTGCAAGACAAT AGG Intergenic
No off target data available for this crispr