ID: 937000977

View in Genome Browser
Species Human (GRCh38)
Location 2:118467351-118467373
Sequence ATCTGCGTGTTCTGCACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937000977_937000989 30 Left 937000977 2:118467351-118467373 CCATGAGTGCAGAACACGCAGAT No data
Right 937000989 2:118467404-118467426 CCCTCTGCATCAAAGACCTTGGG No data
937000977_937000981 4 Left 937000977 2:118467351-118467373 CCATGAGTGCAGAACACGCAGAT No data
Right 937000981 2:118467378-118467400 AGGGTGAACAATCTATCCCCTGG No data
937000977_937000987 29 Left 937000977 2:118467351-118467373 CCATGAGTGCAGAACACGCAGAT No data
Right 937000987 2:118467403-118467425 CCCCTCTGCATCAAAGACCTTGG No data
937000977_937000982 5 Left 937000977 2:118467351-118467373 CCATGAGTGCAGAACACGCAGAT No data
Right 937000982 2:118467379-118467401 GGGTGAACAATCTATCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937000977 Original CRISPR ATCTGCGTGTTCTGCACTCA TGG (reversed) Intergenic
No off target data available for this crispr