ID: 937000982

View in Genome Browser
Species Human (GRCh38)
Location 2:118467379-118467401
Sequence GGGTGAACAATCTATCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937000976_937000982 28 Left 937000976 2:118467328-118467350 CCATGCATAATTGGTTGTTGAAT No data
Right 937000982 2:118467379-118467401 GGGTGAACAATCTATCCCCTGGG No data
937000977_937000982 5 Left 937000977 2:118467351-118467373 CCATGAGTGCAGAACACGCAGAT No data
Right 937000982 2:118467379-118467401 GGGTGAACAATCTATCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937000982 Original CRISPR GGGTGAACAATCTATCCCCT GGG Intergenic
No off target data available for this crispr