ID: 937003607

View in Genome Browser
Species Human (GRCh38)
Location 2:118490819-118490841
Sequence GGCACAAGTTGCTCAAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937003607_937003617 28 Left 937003607 2:118490819-118490841 CCTTTCTTTGAGCAACTTGTGCC No data
Right 937003617 2:118490870-118490892 TGGGTGACCAAAATGGAAAAAGG No data
937003607_937003608 -9 Left 937003607 2:118490819-118490841 CCTTTCTTTGAGCAACTTGTGCC No data
Right 937003608 2:118490833-118490855 ACTTGTGCCAGTACCGCAACAGG No data
937003607_937003612 8 Left 937003607 2:118490819-118490841 CCTTTCTTTGAGCAACTTGTGCC No data
Right 937003612 2:118490850-118490872 AACAGGCAGTATGGCACCCTTGG No data
937003607_937003610 -1 Left 937003607 2:118490819-118490841 CCTTTCTTTGAGCAACTTGTGCC No data
Right 937003610 2:118490841-118490863 CAGTACCGCAACAGGCAGTATGG No data
937003607_937003614 21 Left 937003607 2:118490819-118490841 CCTTTCTTTGAGCAACTTGTGCC No data
Right 937003614 2:118490863-118490885 GCACCCTTGGGTGACCAAAATGG No data
937003607_937003613 9 Left 937003607 2:118490819-118490841 CCTTTCTTTGAGCAACTTGTGCC No data
Right 937003613 2:118490851-118490873 ACAGGCAGTATGGCACCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937003607 Original CRISPR GGCACAAGTTGCTCAAAGAA AGG (reversed) Intergenic
No off target data available for this crispr