ID: 937003609

View in Genome Browser
Species Human (GRCh38)
Location 2:118490840-118490862
Sequence CATACTGCCTGTTGCGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937003609_937003614 0 Left 937003609 2:118490840-118490862 CCAGTACCGCAACAGGCAGTATG No data
Right 937003614 2:118490863-118490885 GCACCCTTGGGTGACCAAAATGG No data
937003609_937003617 7 Left 937003609 2:118490840-118490862 CCAGTACCGCAACAGGCAGTATG No data
Right 937003617 2:118490870-118490892 TGGGTGACCAAAATGGAAAAAGG No data
937003609_937003618 13 Left 937003609 2:118490840-118490862 CCAGTACCGCAACAGGCAGTATG No data
Right 937003618 2:118490876-118490898 ACCAAAATGGAAAAAGGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937003609 Original CRISPR CATACTGCCTGTTGCGGTAC TGG (reversed) Intergenic
No off target data available for this crispr