ID: 937003611

View in Genome Browser
Species Human (GRCh38)
Location 2:118490846-118490868
Sequence GGGTGCCATACTGCCTGTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937003611_937003618 7 Left 937003611 2:118490846-118490868 CCGCAACAGGCAGTATGGCACCC No data
Right 937003618 2:118490876-118490898 ACCAAAATGGAAAAAGGTTATGG No data
937003611_937003614 -6 Left 937003611 2:118490846-118490868 CCGCAACAGGCAGTATGGCACCC No data
Right 937003614 2:118490863-118490885 GCACCCTTGGGTGACCAAAATGG No data
937003611_937003617 1 Left 937003611 2:118490846-118490868 CCGCAACAGGCAGTATGGCACCC No data
Right 937003617 2:118490870-118490892 TGGGTGACCAAAATGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937003611 Original CRISPR GGGTGCCATACTGCCTGTTG CGG (reversed) Intergenic
No off target data available for this crispr