ID: 937003614

View in Genome Browser
Species Human (GRCh38)
Location 2:118490863-118490885
Sequence GCACCCTTGGGTGACCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937003611_937003614 -6 Left 937003611 2:118490846-118490868 CCGCAACAGGCAGTATGGCACCC No data
Right 937003614 2:118490863-118490885 GCACCCTTGGGTGACCAAAATGG No data
937003609_937003614 0 Left 937003609 2:118490840-118490862 CCAGTACCGCAACAGGCAGTATG No data
Right 937003614 2:118490863-118490885 GCACCCTTGGGTGACCAAAATGG No data
937003607_937003614 21 Left 937003607 2:118490819-118490841 CCTTTCTTTGAGCAACTTGTGCC No data
Right 937003614 2:118490863-118490885 GCACCCTTGGGTGACCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937003614 Original CRISPR GCACCCTTGGGTGACCAAAA TGG Intergenic
No off target data available for this crispr