ID: 937003617

View in Genome Browser
Species Human (GRCh38)
Location 2:118490870-118490892
Sequence TGGGTGACCAAAATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937003609_937003617 7 Left 937003609 2:118490840-118490862 CCAGTACCGCAACAGGCAGTATG No data
Right 937003617 2:118490870-118490892 TGGGTGACCAAAATGGAAAAAGG No data
937003611_937003617 1 Left 937003611 2:118490846-118490868 CCGCAACAGGCAGTATGGCACCC No data
Right 937003617 2:118490870-118490892 TGGGTGACCAAAATGGAAAAAGG No data
937003607_937003617 28 Left 937003607 2:118490819-118490841 CCTTTCTTTGAGCAACTTGTGCC No data
Right 937003617 2:118490870-118490892 TGGGTGACCAAAATGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937003617 Original CRISPR TGGGTGACCAAAATGGAAAA AGG Intergenic
No off target data available for this crispr