ID: 937003618

View in Genome Browser
Species Human (GRCh38)
Location 2:118490876-118490898
Sequence ACCAAAATGGAAAAAGGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937003611_937003618 7 Left 937003611 2:118490846-118490868 CCGCAACAGGCAGTATGGCACCC No data
Right 937003618 2:118490876-118490898 ACCAAAATGGAAAAAGGTTATGG No data
937003609_937003618 13 Left 937003609 2:118490840-118490862 CCAGTACCGCAACAGGCAGTATG No data
Right 937003618 2:118490876-118490898 ACCAAAATGGAAAAAGGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937003618 Original CRISPR ACCAAAATGGAAAAAGGTTA TGG Intergenic
No off target data available for this crispr